Blog Arasys Perfector - Xanya Sofra Weiss

Free radicals in biology

Free radicals play an important role in a number of biological processes, some of which are necessary for life, such as the intracellular killing of bacteria by neutrophil granulocytes. Free radicals have also been implicated in certain cell signalling processes ^[5]. This is dubbed redox signaling.

The two most important oxygen-centered free radicals are superoxide and hydroxyl radical. They are derived from molecular oxygen under reducing conditions. However, because of their reactivity, these same free radicals can participate in unwanted side reactions resulting in cell damage. Many forms of cancer are thought to be the result of reactions between free radicals and DNA, resulting in mutations that can adversely affect the cell cycle and potentially lead to malignancy. Some of the symptoms of aging such as atherosclerosis are also attributed to free-radical induced oxidation of many of the chemicals making up the body. In addition free radicals contribute to alcohol-induced liver damage, perhaps more than alcohol itself. Radicals in cigarette smoke have been implicated in inactivation of alpha 1-antitrypsin in the lung. This process promotes the development of emphysema.

Free radicals may also be involved in Parkinson’s disease, senile and drug-induced deafness, schizophrenia, and Alzheimer’s. The classic free-radical syndrome, the iron-storage disease hemochromatosis, is typically associated with a constellation of free-radical-related symptoms including movement disorder, psychosis, skin pigmentary melanin abnormalities, deafness, arthritis, and diabetes mellitus. The free radical theory of aging proposes that free radicals underlie the aging process itself, whereas the process of mitohormesis suggests that repeated exposure to free radicals may extend life span.

Because free radicals are necessary for life, the body has a number of mechanisms to minimize free radical induced damage and to repair damage which does occur, such as the enzymes superoxide dismutase, catalase, glutathione peroxidase and glutathione reductase. In addition, antioxidants play a key role in these defense mechanisms. These are often the three vitamins, vitamin A, vitamin C and vitamin E and polyphenol antioxidants. Further, there is good evidence bilirubin and uric acid can act as antioxidants to help neutralize certain free radicals. Bilirubin comes from the breakdown of red blood cells‘ contents, while uric acid is a breakdown product of purines. Too much bilirubin, though, can lead to jaundice, which could eventually damage the central nervous system, while too much uric acid causes gout ^[6].

[edit] Reactive oxygen species

Reactive oxygen species or ROS are species such as superoxide, hydrogen peroxide, and hydroxyl radical and are associated with cell damage. ROSs form as a natural byproduct of the normal metabolism of oxygen and have important roles in cell signaling.

[edit] Loose definition of radicals

In most fields of chemistry, the historical definition of radicals contends that the molecules have nonzero spin. However in fields including spectroscopy, chemical reaction, and astrochemistry, the definition is slightly different. Gerhard Herzberg, who won the Nobel prize for his research of electronic structure and geometry of radicals, suggested a looser definition of free radicals: “any transient (chemically unstable) species (atom, molecule, or ion)”^[7]. The main point of his suggestion is that there are many chemically unstable molecules which have zero spin, such as C₂, C₃, CH₂ and so on. This definition is more convenient for discussions of transient chemical processes and astrochemistry; therefore researchers in these fields prefer to use this loose definition.^[8]

[edit] Diagnostics

Free Radical diagnostic techniques include:

• Electron Spin Resonance

A widely-used technique for studying free radicals, and other paramagnetic species, is electron spin resonance spectroscopy (ESR). This is alternately referred to as “electron paramagnetic resonance” (EPR) spectroscopy. It is conceptually related to nuclear magnetic resonance, though electrons resonate with higher-frequency fields at a given fixed magnetic field than do most nuclei.

• Nuclear magnetic resonance using a phenomenon called CIDNP
• Chemical Labelling

Chemical labelling by quenching with free radicals, e.g. with nitric oxide (NO) or DPPH (2,2-diphenyl-1-picrylhydrazyl), followed by spectroscopic methods like X-ray photoelectron spectroscopy (XPS) or absorption spectroscopy, respectively.

• Use of free radical markers

Stable, specific or non-specific derivates of physiological substances can be measured e.g. lipid peroxidation products (isoprostanes, TBARS), amino acid oxidation products (meta-tyrosine, ortho-tyrosine, hydroxy-Leu, dityrosine etc.), peptide oxidation products (oxidized glutathione - GSSG)

• Indirect method

Measurement of the decrease in the amount of antioxidants (e.g. TAS, reduced glutathione - GSH)

• Trapping agents

Using a chemical species that reacts with free radicals to form a stable product that can then be readily measured (Hydroxyl radical and salicylic acid)

Iontophoresis is a non-invasive method of propelling high concentrations of a charged substance, normally medication or bioactive agents, transdermally by repulsive electromotive force using a small electrical charge applied to an iontophoretic chamber containing a similarly charged active agent and its vehicle. To clarify, one or two chambers are filled with a solution containing an active ingredient and its solvent, termed the vehicle. The positively charged chamber, termed the anode will repel a positively charged chemical, while the negatively charged chamber, termed the cathode, will repel a negatively charged chemical into the skin.

Iontophoresis is well classified for use in transdermal drug delivery. Unlike transdermal patches, this method relies on active transportation within an electric field. In the presence of an electric field electromigration and electroosmosis are the dominant forces in mass transport. These movements are measured in units of chemical flux, commonly µmol/cm²h. For more information see Fick’s Law of Diffusion.

Mechanism

There are a number of factors that influence iontophoretic transport including skin pH, drug concentration and characteristics, ionic competition, molecular size, current, voltage, time applied and skin resistance. The current density of the treatment electrode is perhaps the most important variable relative to the degree of ion transfer. Studies suggest that comparable iontophoretic doses delivered at low currents over longer periods are more effective than those delivered by high currents over a short periods (Anderson et al., 2003).

The isoelectric point of the skin is ~4; therefore, under physiological conditions, with the surface of the skin also buffered at or near 7.4, the membrane has a net negative charge and electroosmotic flow is from cathode (-) to anode (+). The phenomenon of electroosmosis has been used as a means to augment the anodic delivery of (in particular) large, positively charged drugs, the transport numbers of which are often extremely small (and whose iontophoretic enhancement therefore depends heavily upon electroosmosis) and to promote the transdermal migration of uncharged, yet polar, molecules, the passive permeation of which is typically very small.

The application of a charge to the skin alters the skin’s permeability increasing migration of the active ingredient into the epidermis. There are a number of pathways that the ingredients could take, but research suggests that the majority of drugs permeate the skin via appendageal pores, including hair follicles and sweat glands, although some delivery is via the paracellular channels and minimal quantities are transcellular.

Transport of lipophilic drug molecules is believed to be facilitated by its dissolution into the lipid matrix of the stratum corneum however hydrophilic drugs which are thought to permeate through the open pores or cutaneous appendages (hair follicle and sebaceous glands) only accounts for 0.1% of the total skin surface area.^[1]

Uses

Reverse iontophoresis is the term used to describe the process whereby molecules are removed from within the body for detection. In reverse iontophoresis the negative charge of the skin at buffered pH causes it to be permselective to cations causing solvent flow towards the anode. This flow is the dominant force allowing movement of neutral molecules, including glucose, across the skin. This technology is currently being used in such devices as the GlucoWatch which allows for blood glucose detection across skin layers using reverse iontophoresis.

Iontophoresis is commonly used by physical therapists for the application of anti-inflammatory medications. Common diagnoses treated with Iontophoresis include plantar fasciitis, bursitis and some types of hyperhidrosis ^[2]. There are around ten iontophoresis machines currently available to treat hyperhidrosis^[3]. In this specific application, the solution chosen is usually tap water but better results can be obtained using glycopyrronium bromide, a cholinergic inhibitor^[4]. Iontophoresis of Acetylcholine is used in research as a way to test the health of the endothelium by stimulating endothelium dependent generation of nitric oxide and subsequent microvascular vasodilation. Acetylcholine is positively charged and therefore placed in the anode.

Use with Diagnosis and Monitoring of Cystic Fibrosis (CF): The most commonly-used form of testing for CF is the sweat test. Sweat-testing involves application of a medication that stimulates sweating (pilocarpine) to one electrode of an apparatus and running electric current to a separate electrode on the skin. This process, called iontophoresis, causes sweating; the sweat is then collected on filter paper or in a capillary tube and analyzed for abnormal amounts of sodium and chloride. People with CF have increased amounts of sodium and chloride in their sweat.

S. Lally¹, C. Y. Tan¹, D. Owens¹ and G. H. Tomkin^{1, 2}

Received: 12 August 2005 Accepted: 3 December 2005 Published online: 4 March 2006

Li J, Qin Z, Liang Z.

Department of Pharmacology, Soochow University School of Medicine, Suzhou, PR China. lijun860227@hotmail.com

BACKGROUND: Previous study reported that resveratrol has anti-tumor activity. In this study, we investigated the involvement of autophagy in the resveratrol-induced apoptotic death of human U251 glioma cells. METHODS: The growth inhibition of U251 cells induced by resveratrol was assessed with methyl thiazolyl tetrazolium (MTT). The activation of autophagy and proapoptotic effect were characterized by monodansylcadaverine labeling and Hoechst stain, respectively. Mitochondrialtransmembrane potential (DeltaPsim) was measured as a function of drug treatment using 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide (JC-1). The role of autophagy and apoptosis in the resveratrol-induced death of U251 cells was assessed using autophagic and caspase inhibitors. Immunofluorescence, flow cytometry, and Western blot analysis were used to study the apoptotic and autophagic mechanisms. RESULTS: Methyl thiazolyl tetrazolium (MTT) assays indicated that resveratrol decreased the viability of U251 cells in a dose- and time-dependent manner. Flow cytometry analysis indicated that resveratrol increased cell population at sub-G1 phase, an index of apoptosis. Furthermore, resveratrol-induced cell death was associated with a collapse of the mitochondrial membrane potential. The pan-caspase inhibitor Z-VAD-fmk suppressed resveratrol-induced U251 cell death. Resveratrol stimulated autophagy was evidenced by punctuate monodansylcadaverine(MDC) staining and microtubule-associated protein light chain 3 (LC3) immunoreactivty. Resveratrol also increased protein levels of beclin 1 and membrane form LC3 (LC3-II). Autophagy inhibitors 3-methylademine (3-MA) and bafilomycin A1 sensitized the cytotoxicity of resveratrol. CONCLUSION: Together, these findings indicate that resveratrol induces autophagy in human U251 glioma cells and autophagy suppressed resveratrol-induced apoptosis. This study thus suggests that autophagy inhibitors can increase the cytotoxicity of resveratrol to glioma cells.

BMC Cancer. 2009 Jun 30;9:215.

Identification of Barkor as a mammalian
autophagy-specific factor for Beclin 1 and class III
phosphatidylinositol 3-kinase
Qiming Suna, Weiliang Fana, Keling Chena, Xiaojun Dingb, She Chenb, and Qing Zhonga,1
aDivision of Biochemistry and Molecular Biology, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720; and bNational
Institute of Biological Sciences, Beijing 102206, China
Communicated by Xiaodong Wang, University of Texas Southwestern Medical Center, Dallas, TX, October 17, 2008 (received for review October 10, 2008)
Autophagy mediates the cellular response to nutrient deprivation,
protein aggregation, and pathogen invasion in human. Dysfunction
of autophagy has been implicated in multiple human diseases including
cancer. The identification of novel autophagy factors in mammalian
cells will provide critical mechanistic insights into how this
complicated cellular pathway responds to a broad range of challenges.
Here, we report the cloning of an autophagy-specific protein
that we called Barkor (Beclin 1-associated autophagy-related key
regulator) through direct interaction with Beclin 1 in the human
phosphatidylinositol 3-kinase class III complex. Barkor shares 18%
sequence identity and 32% sequence similarity with yeast Atg14.
Elimination of Barkor expression by RNA interference compromises
starvation- and rapamycin-induced LC3 lipidation and autophagosome
formation. Overexpression of Barkor leads to autophagy activation
and increased number and enlarged volume of autophagosomes.
Tellingly, Barkor is also required for suppression of the
autophagy-mediated intracellular survival of Salmonella typhimurium
in mammalian cells. Mechanistically, Barkor competes with
UV radiation resistance associated gene product (UVRAG) for interaction
with Beclin 1, and the complex formation of Barkor and Beclin1
is required for their localizations to autophagosomes. Therefore, we
define a regulatory signaling pathway mediated by Barkor that
positively controls autophagy through Beclin 1 and represents a
potential target for drug development in the treatment of human
diseases implicated in autophagic dysfunction.
Atg14 autophagosome LC3 Salmonella UVRAG
One of the central regulators of autophagy in mammalian cells
is Beclin 1 (1–3). Beclin 1 is a component of the class III
phosphatidylinositol 3-kinase (PI3KC3) complex, which also contains
a PI3K catalytic subunit and a regulatory subunit (p150) (4).
Beclin 1 was identified as a haploid insufficient tumor suppressor
gene (3). It is monoallelically deleted in ovarian, breast, and
prostate cancers. Heterozygous Beclin 1 / mice have reduced
autophagy activity and increased incidence of spontaneous tumors
(5, 6). Allelic loss of Beclin 1 leads to genome instability upon
metabolic stress (7, 8). All of this evidence illustrates a role for
Beclin 1 and autophagy in cancer development.
Notably, Beclin 1 and PI3KC3 have pleiotropic functions in
multiple cellular processes. PI3KC3 is not only required for autophagy,
but also has broad functions in endocytic protein sorting (9).
Functional equivalents of Beclin 1/PI3KC3/p150 in yeast, Vps30/
Atg6-Vps15-Vps34, are known to play a critical role in autophagy
and in vacuolar protein sorting (VPS) (1, 10). The specificity of
PI3KC3 in yeast is determined by different complex compositions.
Two regulatory proteins, Atg14 and Vps38, direct the core PI3K
complex to either the phagophore assembly site (PAS) for autophagy
or the endosome for VPS (10, 11), respectively, to execute
their functions in autophagy or VPS. Atg14 is required for mediating
the localization of the core PI3KC3 complex to PAS and is
also important in recruiting downstream Atg proteins such as Atg2,
Atg8, Atg16, and the Atg12-Atg5 conjugate to the PAS for membrane
elongation and vesicle completion (12, 13). In contrast, Vps38
is responsible for the endosomal localization of the PI3K complex
(11). Surprisingly, such regulatory mechanisms directing PI3KC3
specificity have not been identified in mammals.
How the function of Beclin 1 is specifically directed toward
autophagosomes in mammalian cells has remained elusive. We
speculate that there are autophagy-specific factors mediating
Beclin 1 activity in autophagy. We used a biochemical approach
to purify and proteomic methods to characterize the Beclin 1
complex. Here, we report the identification of a Beclin 1-
associated protein that promotes autophagy specifically through
the interaction with Beclin 1.
Results
Identification of Barkor as a Beclin 1-Interacting Protein. To search
for Beclin 1 regulatory proteins, we generated a cell line from
human osteosarcoma U2OS cells that is stably transfected with
ZZ-Beclin 1-FLAG under the control of doxycycline [supporting
information (SI) Fig. S1A]. The expression of Beclin 1 was adjusted
by the titration of doxycycline, and a dose (20 ng/mL) that induces
expression of tagged Beclin 1 close to the endogenous level was
selected (Fig. S1B). The tagged Beclin 1 was purified from cell
extracts by sequential affinity chromatography steps, and the final
FLAGpeptide eluate was subjected to 4–12% gradient SDS/PAGE
and visualized by silver staining (Fig. 1A). The indicated bands were
excised and analyzed by mass spectrometry. In addition to the
known components of the Beclin 1 complex, namely the PI3K
catalytic subunit, p150 regulatory subunit, and UVRAG, we also
identified a 68-kDa protein by mass spectrometry, KIAA0831 (Fig.
1A), which we called Barkor (Beclin 1-associated autophagy related
key regulator). We were able to purify the same complex from
human embryonic kidney 293T cells expressing tagged Beclin 1,
indicating that the formation of this complex is not cell type-specific
(Fig. 1B). Bioinformatic analysis revealed that Barkor contains an
N-terminal zinc finger motif and a central coiled-coil domain
(CCD) (Fig. S2) and a domain organization similar to Atg14 in
yeast. Barkor also shares 18% sequence identity and 32% sequence
similarity with yeast Atg14 (Fig. S3). The identities of these
interacting proteins were further confirmed by immunoblotting
analysis (Fig. S4). Although another Beclin 1-interacting protein,
Bcl-2 (14), could not be visualized by silver staining, its presence in
the final eluate was validated by immunoblotting (Fig. S4). The
interaction of Barkor and Beclin 1 was further confirmed by the
Author contributions: Q.Z. designed research; Q.S., W.F., and K.C. performed research; X.D.
and S.C. contributed new reagents/analytic tools; Q.S., W.F., and Q.Z. analyzed data; and
Q.S. and Q.Z. wrote the paper.
The authors declare no conflict of interest.
Freely available online through the PNAS open access option.
1Towhomcorrespondence should be addressed at: Department of Molecular and Cell Biology,
University of California, 316 Barker Hall, Berkeley, CA 94720. E-mail: qingzhong@
berkeley.edu.
This article contains supporting information online at www.pnas.org/cgi/content/full/
0810452105/DCSupplemental.
© 2008 by The National Academy of Sciences of the USA
www.pnas.org cgi doi 10.1073 pnas.0810452105 PNAS December 9, 2008 vol. 105 no. 49 19211–19216
BIOCHEMISTRY
reciprocal endogenous coimmunoprecipitation of Barkor and Beclin
1 with each other’s antibodies (Fig. 1C).
Barkor Is Important for Efficient Production of PI3P in Vivo. Because
Beclin 1 is a major component of the PI3KC3 complex, we checked
whether Barkor is also a component of this complex. Indeed,
Barkor and Beclin 1 were coimmunoprecipitated with PI3KC3
antibody (Fig. S5), indicating that Barkor is part of the PI3KC3
complex.
The interaction between Beclin 1 and PI3KC3 was not affected
by either Barkor-knockdown (Fig. S6 A and B) or overexpression
(Fig. S6C). Because Barkor interacts directly with Beclin 1, we
asked whether Beclin 1 is required for the association between
PI3KC3 and Barkor. Indeed, in Beclin 1-knockdown (Fig. S6D)
cells, the amount of Barkor in the PI3KC3 immunoprecipitate (Fig.
1D, lane 7) was dramatically reduced compared with that in Beclin
1-proficient cells (Fig. 1D, lane 3). The amount of PI3KC3 in
Barkor immunoprecipitate in Beclin 1-knockdown cells (Fig. 1D,
lane was also greatly compromised compared with that in Beclin
1-proficient cells (Fig. 1D, lane 4). In summary, Beclin 1 is required
for the interaction between PI3KC3 and Barkor.
To test whether Barkor might regulate PI3KC3 activity, we
measured its lipid phosphorylation activity in wild-type and Barkorknockdown
cells. PI3KC3 phosphorylates the 3 -hydroxyl position
of the phosphatidylinositol (PtdIns) ring to produce PtdIns3P
(PI3P) (9). The production of PI3P by PI3KC3 could be visualized
and quantified by fluorescence of the GFP-tagged double FYVE
finger of the Hrs protein (15). Because the FYVE probe specifically
binds to PI3P, the only end product of PI3KC3, we could measure
PI3KC3 activity by detecting FYVE fluorescence. PI3P production
was diminished in Barkor knockdown cells compared to that in
wild-type cells, and could be further depleted by treatment of the
PI3K inhibitor 3-methyladeline (3-MA) (Fig. 1 E and F).
Barkor Is Required for LC3 Conjugation and Autophagosome Assembly.
To demonstrate the role of Barkor in autophagy directly, we
generated doxycycline-inducible RNAi-knockdown cell lines for
both Beclin 1 and Barkor inU2OS cells (Fig. S7 A and B).Afaithful
marker of autophagy activity is LC3 conjugation to phosphatidylethanolamine
(PE), which is strongly induced by stimuli such as
starvation or rapamycin treatment (16). The LC3-conjugated form
(also called LC3II) migrates slightly faster than the cytosolic free
form (LC3I). In wild-type cells, the LC3II form was dramatically
increased upon starvation (Fig. 2A, lanes 3 and 7) compared with
that in untreated cells (Fig. 2A, lanes 1 and 5). However, in
Barkor-inducible knockdown cells, the LC3II form was decreased
(Fig. 2A, lane at a level comparable with that of Beclin
1-knockdown cells (Fig. 2A, lane 4). Similarly, LC3II was
strongly induced in rapamycin-treated wild-type cells (Fig. 2B,
lane 3), but not in the Barkor-knockdown cells (Fig. 2B, lane 7).
Pretreatment with the protease inhibitors pepstatin and E-64D
accumulated the LC3II form in rapamycin-treated (Fig. 2B, lane
4) and untreated (Fig. 2B, lane 2) Barkor-proficient cells, but
had no effect on LC3 conjugation in Barkor-deficient cells (Fig.
2B, lanes 6 and 8). All of these data indicate that Barkor is
essential for LC3 conjugation to PE and for autophagy activation.
Consistently, LC3 puncta were also dramatically compromised
in Barkor knockdown cells (Fig. S8).
To visualize autophagosome formation directly, we performed
an electron microscopic analysis. During autophagy, cytoplasmic
components, including proteins and organelles, are engulfed by
double-membrane autophagosomes, which fuse to lysosomal vesicles
to form autolysosomes where the contents are degraded into
their components (17). Autophagic vacuoles (AVs) that include
autophagosomes and autolysosomes could be captured under transmission
electron microscope and are shown as double-membrane
vesicles (autophagosomes) or single-membrane vesicles (autolysosomes)
that contain intracellular contents including cytosol and
organelles (mitochondria and/or endoplasmic reticulum) (Fig. 2E,
marked by arrows) (17). In Barkor wild-type cells, we observed
abundant AVs in response to nutrient deprivation (Fig. 2 C, E, and
F). AVs were rarely observed in Barkor-knockdown cells (Fig. 2 D
and F).
We then asked whether forced expression of Barkor would
stimulate autophagosome formation. For this purpose, we set up
a Barkor stable overexpression (OE) cell line in U2OS, and
Fig. 1. Barkor is a major component of the Beclin 1–PI3KC3 complex. (A) Silver staining of the tandem affinity-purified Beclin 1 complex or vector alone in U2OS cells.
All the marked bands were identified by mass spectrometry. (B) A similar Beclin 1 complex was purified from human kidney embryonic HEK293T cells. (C) Reciprocal
coimmunoprecipitation of Barkor and Beclin 1. 293T cell extracts were immunoprecipitated with either anti-Barkor or Beclin 1 antibody and then analyzed. (D) Beclin
1 bridges the interaction between PI3KC3 and Barkor. Beclin 1-knockdown 293T cells or control cells were transfected with FLAG-PI3KC3 and Myc-Barkor. Whole-cell
lysates were immunoprecipitated with anti-FLAG or Myc antibodies and analyzed. (E) Barkor-knockdown decreases the activity of PI3KC3 in vivo. Barkor-knockdown
U2OS cells were transfected with FYVE2-EGFP expression vector. Thirty hours after transfection, cells were treated with 5mM3-MA for another 4 h. FYVE2-EGFP was
quantified in F.
19212 www.pnas.org cgi doi 10.1073 pnas.0810452105 Sun et al.
autophagic vacuole formation was observed in these cells. The
number of AVs was dramatically increased in Barkor OE cells
(Fig. 2 H–J) compared with that in parental cells (Fig. 2 G and
J). Also, AVs in Barkor OE cells were more heterogeneous, and
we observed a significant amount of large AVs (Fig. 2 H and I).
The average size of AVs in Barkor OE cells was nearly doubled
compared with that in control cells (Fig. 2K). Consistently,
overexpression of Barkor in HEK293T cells led to autophagy
activation, illustrated by increasing amounts of the LC3II form
(Fig. 2L). All of these data demonstrate that Barkor is important
in autophagosome formation and expansion.
Barkor Is Critical for Autophagy-Mediated Bacterial Clearance. Autophagy
has been recognized as an important defensive mechanism
to suppress bacterial infection (18). It has been reported that
infection by Salmonella typhimurium, a causative agent for food
poisoning and typhoid fever, is controlled by autophagy (19–21).
We first asked whether autophagy is required for controlling
bacterial infection in nonphagocytic mammalian cells. Mouse embryonic
fibroblasts (MEFs) knocked out of Atg7 (22), an essential
gene for autophagy, were infected with Salmonella marked with
GFP, and uptake of Salmonella was monitored microscopically by
green fluorescence. As expected, Atg7 / MEFs were more permissive
for intracellular replication by Salmonella than wild-type
cells, allowing remarkably increased GFP fluorescence in the
cytosol (Fig. 3A). We further performed a quantitative assay to
measure the bacterial growth. Salmonella growth was accelerated in
Atg7-knockout cells compared with wild-type cells (Fig. 3B), confirming
that autophagy is required for Salmonella amplification in
nonphagocytic mammalian cells.
A similar phenomenon was observed in Barkor-knockdown
cells, namely that there was more bacterial growth when
Barkor protein was eliminated (Fig. 3C). The same quantitative
assay for bacterial growth indicated that a 2- to 3-fold
increase in bacterial replication could be detected in Barkordeficient
over Barkor-proficient cells (Fig. 3D). This result
demonstrates that Barkor is crucial for autophagy-mediated
bacterial elimination in mammalian cells.
Barkor Interacts with Beclin 1 Through CCDs. We performed an
in-depth analysis of the interaction between Barkor and Beclin
1. We constructed a series of vectors that express various
deletion mutants of both Beclin 1 and Barkor on the basis of their
putative structures. Barkor contains an N-terminal zinc finger
motif and a central CCD (Fig. 4A), and Beclin 1 consists of 3
domains: an N-terminal BH3 domain, a central CCD, and an
evolutionarily conserved domain at the C terminus (Fig. 4B)
(23). IP assays showed that all of the Barkor fragments containing
CCD, including CCD alone (Fig. 4A, lanes 2, 4, 5, and 6),
immunoprecipitated Beclin 1, whereas Barkor fragments lacking
CCD failed to bind (Fig. 4A, lanes 3 and 7), demonstrating that
Barkor specifically binds to Beclin 1 through its CCD (Fig. 4A).
Additionally, Beclin 1 specifically interacts with Barkor through
its CCD as well (Fig. 4B).
Barkor and UVRAG Form Mutually Exclusive Complexes with Beclin 1.
UVRAG is a recently identified positive regulator of Beclin 1
(24) and interacts with Beclin 1 through a CCD interaction.
Because the same binding surface of Beclin 1 is used to bind
to both Barkor and UVRAG, we speculated that Barkor and
UVRAG might form mutually exclusive complexes with Beclin
1 through competition. To test this hypothesis, we examined
the direct interaction among Barkor, UVRAG, and Beclin 1
in an in vitro binding assay. In this assay, we purified different
recombinant CCDs of Beclin 1, Barkor, and UVRAG from
Escherichia coli (Fig. S9) and performed in vitro binding
reactions. As shown in Fig. 4C (Bottom), both Barkor CCD
(lane 4) and UVRAG CCD (lane 6) bound to Beclin 1 CCD
directly. Similar experiments were performed by using Barkor
CCD (Fig. S10A) or UVRAG CCD (Fig. S10B) as baits; both
CCDs bind to Beclin 1 but not to each other.
We further investigated whether Barkor and UVRAG form
Fig. 2. Barkor is required for LC3 lipidation and autophagosome formation. (A)
LC3 conjugation was examined in Beclin 1 and Barkor-knockdown U2OS cells in
complete medium (DMEM 10% FBS) or starvation medium (Earle’s balanced
salt solution, EBSS). (B) LC3 conjugation was examined in Barkor-knockdown cells
treated with 500 nM rapamycin overnight. Proteases inhibitors (2 g/mL E64D
and 2 g/mL pepstatin for 4 h) were used to block lysosomal degradation. (C–E).
Electron microscopic (EM) analysis of Barkor-knockdown cells. Both control cells
(C) and Barkor-knockdown cells (D) were starved in EBSS for 1 h and analyzed by
transmission electron microscopy. (E) High-magnification picture of the framed
area in C showing AVs (marked by arrows) that contain intracellular contents.
[Scale bars: 2 M (C), 2 M (D), and 1 M (E).] (F) AVs per cross-sectioned cell
(mean SD; n 21) under EM were calculated and summarized. CM, complete
medium. Arrows indicate autophagic vacuole. (G–I) Barkor-overexpression (OE)
U2OS cells (H and I) and U2OS parental cells (G) were observed under EM. (I)
High-magnification picture of the framed area in H shows AVs (marked by
arrows) that contain intracellular contents. [Scale bars: 1 M (G–I).] (J) AVs per
cross-sectioned cell under EM were calculated. (K) The average size of AVs in
Barkor OE cells or normal cells was calculated and summarized. (L) HEK293T cells
were transfected with Barkor (wild-type or CCD deletion mutant) or UVRAG, and
LC3 conjugation was examined in these cells.
Sun et al. PNAS December 9, 2008 vol. 105 no. 49 19213
BIOCHEMISTRY
mutually exclusive subcomplexes with Beclin 1 in vivo. We
performed coimmunoprecipitation experiments to detect Beclin
1, Barkor, and UVRAG interactions in vivo. Beclin 1
antibody (Fig. 4D, lane 3) but not control antibody (Fig. 4D,
lane 2) immunoprecipitated with both Barkor and UVRAG.
However, Beclin 1 interacted with both Barkor and UVRAG,
Fig. 3. Barkor is indispensable for autophagymediated
suppression of bacterial replication in
vivo. (A) Atg7 / and Atg7 / MEFs cells were
infected with wild-type GFP-marked S. typhimurium
(SL1344) (green) for 8 h and analyzed by
immunostaining. Cells were counterstained with
anti-tubulin antibody (red). (B) Atg7 / or
Atg7 / MEFs were infected with S. typhimurium
(SL1344) for indicated times. The infected cells
were treated with gentamicin sulfate to block
extracellular bacterial amplification and then
lysed, and internalized bacteria were plated on
Petri dishes.Thereplication of bacteriawasquantifiedbycounting
the colonynumberonthe Petri
plates. (C) Barkor-knockdown U2OS cells were
induced by doxycycline for 2 days and infected
with S. typhimurium as described in A. (D) The
bacterial growth in Barkor-knockdown U2OS
cells was measured as described in B.
Fig. 4. Barkor and UVRAG form distinct
subcomplexes with Beclin 1 through their
CCDs. (A) Barkor binds to Beclin 1 through
its CCD. 293T cells were transfected with
FLAG-Beclin 1, Myc-Barkor, or its Myctagged
mutants. Whole-cell lysates (WCLs)
were immunoprecipitated (IP) with anti-
Myc followed by immunoblotting (IB) with
anti-FLAG. § indicates a nonspecific band.
(B) Beclin 1 binds to Barkor through its CCD.
293T cells were transfected with Myc-
Barkor, FLAG-Beclin 1, or its FLAG-tagged
mutants. WCLs were immunoprecipitated
with anti-FLAG followed by the IB with anti-
Myc. (C) Direct interaction of Beclin 1
with Barkor or UVRAG. A Ni-column was
incubated first with His-Beclin 1-CC and
then with FLAG-tagged Beclin 1-CC, Barkor-
CC, and UVRAG-CC. Proteins bound to
beadsandinputswereanalyzed. (D) Barkor
and UVRAG form distinct subcomplexes
with Beclin 1. 293T cells were transfected
with FLAG-UVRAG, Myc-Barkor, and HABeclin
1. WCLs were immunoprecipitated
with anti-FLAG, anti-HA, or Myc, and the
immunoprecipitates were analyzed. (E)
Barkor competes with UVRAG for binding
to Beclin 1.UVRAGwasfirst incubated with
Beclin 1 in vitro; increasing doses of the
Barkor CCD were then added to the reactions.
After extensivewashing,theproteins
bound to beads were analyzed by SDS/
PAGE stained with Coomassie blue. (F)
UVRAG competes with Barkor–Beclin 1 interaction
in vivo. HA-Beclin 1 was cotransfected
into HEK293T cells with Myc-Barkor
or FLAG-taggedUVRAG.WCLswereimmunoprecipitated
with anti-HA followed by
the IB with antibodies against Myc, FLAG,
or HA.
19214 www.pnas.org cgi doi 10.1073 pnas.0810452105 Sun et al.
but no interaction was detected between Barkor and UVRAG
(Fig. 4D).
We then asked whether Barkor competes with UVRAG for
Beclin 1 binding. In the binding assay, we first incubated His6-Beclin
1 CCD with Ni-beads and then withUVRAGCCD to allow Beclin
1–UVRAG (Fig. 4E) complex formation. Excess amounts of
Barkor CCD were added to the reaction mixture at different
concentrations to compete with UVRAG–Beclin 1 binding. As
expected, UVRAG CCD was displaced from the Beclin 1 complex
in a dose-dependent manner (Fig. 4E). A similar competition assay
was performed in vivo by coimmunoprecipitation. Barkor could be
efficiently coimmunoprecipitated with antibodies against HABeclin
1 (Fig. 4F, lane 5). However, Beclin 1–Barkor interaction was
diminished when UVRAG was overexpressed (Fig. 4F, lane 6).
Therefore, an excess amount of UVRAG could compete with the
Beclin 1–Barkor interaction in vivo. These results indicate that
Barkor and UVRAG interact with Beclin 1 in a mutually exclusive
manner through direct competition.
Subcellular Localization of Barkor Is Regulated by Autophagy Stress.
We first investigated Barkor subcellular localization in human
osteosarcoma U2OS cells transfected with GFP-Barkor. Approximately
20% of GFP-positive cells displayed a scarce punctate
staining, and the rest showed a diffuse cytoplasmic staining (Fig.
5AI). The percentage of cells containing abundant Barkor foci was
dramatically augmented ( 80%) by treatment with the autophagy
inducer rapamycin (Fig. 5AII) or nutrient withdrawal (Fig. 5AIII).
Treatment with the autophagy inhibitor 3-MA converted the
punctate pattern of Barkor to a diffuse cytoplasmic staining (Fig.
5AIV). A statistical analysis of foci per cell or number of cells with
foci was also consistent with the observations (Fig. 5 B and C). The
Barkor punctate staining colocalized nearly perfectly with LC3 in
the unstressed condition (Fig. 5D I–III) or upon rapamycin treatment
(Fig. 5D IV–VI). All of these results prove that Barkor resides
predominantly on autophagosomes, which is regulated by
autophagy stimuli. As a control, there was no apparent overlap
between Barkor and the early endosome marker EEA1 before or
after rapamycin treatment (Fig. 5D VII–IX and data not shown).
Barkor Promotes Beclin 1 Translocation to Autophagosomes. We next
asked whether Barkor would affect Beclin 1 distribution through
direct interaction. In yeast, Atg6 localizes to the PAS, and this
localization is required for the recruitment of downstream autophagy
proteins (11, 12). However, in mammalian cells, Beclin 1
normally localizes to the trans-Golgi network (4) (Fig. 5E I–III). It
is still elusive how Beclin 1 participates in autophagosome assembly.
Given the location of Barkor on autophagosomes (Fig. 5D), we
speculate that Barkor might promote the translocation of Beclin 1
from the trans-Golgi network to autophagosomes.
We examined the localization of Beclin 1 in the presence of
Barkor expression. When Barkor (GFP-tagged) and Beclin 1
(RFP-tagged) were coexpressed, nearly all Barkor and Beclin 1
proteins were colocalized in cytoplasmic foci (Fig. 5E IV–VI).
These Barkor/Beclin 1-decorated foci overlapped perfectly with the
LC3 staining (Fig. 5E VII–IX), indicating that Beclin 1 is localized
to the autophagosome. The distribution of Barkor and Beclin 1 on
autophagosomes is mediated by their interaction because a Barkor
I
I
I
II
II
II
III
III
III
IV
IV
IV
V
V
VI
VI
VII
VII
VIII
VIII
IX
IX
X XI XII
A B
C
D
E
Fig. 5. Barkor promotes Beclin 1 translocation to autophagosomes through
direct interaction. (A) Subcellular localization of Barkor. Fluorescent Barkor-EGFP
detected in transfected U2OS cells upon mock treatment (I), 500 nM rapamycin
(II), EBSS medium (III), or EBSS and 5mM3-MA, respectively, under a fluorescence
microscopy. (B) Quantification of Barkor-EGFP dots per cell. (C) Quantification of
Barkor-EGFP punctate staining-positive cells. (D) Colocalization of Barkor and
LC3.AU2OSstable cell line expressing Myc-LC3 was transfected with Barkor-EGFP
and then mock treated (I–III) or treated with 500 nM rapamycin (IV–IX) for 12 h.
(I–VI) GFP-Barkor (green) was costained with Myc-LC3 (red). (VII–IX) GFP-Barkor
(green) was costained with endogenous EEA1 (red) (an endosome marker).
(E) U2OS cells were transfected with RFP-Beclin 1. (I–III) RFP-Beclin 1 was
costained with endogenous TGN38 (green) (a trans-Golgi network marker).
(IV–VI) U2OS cells were transfected with Barkor-EGFP (green) and RFP-Beclin
1 (red), and fluorescence of Barkor-EGFP (green) and RFP-Beclin 1 (red) was
observed. (VII–IX) U2OS cells were transfected with RFP-Beclin 1, Myc-Barkor,
and GFP-LC3, and fluorescence of GFP-LC3 (green) and RFP-Beclin 1 (red) was
observed. (X–XII), U2OS cells were transfected with RFP-Beclin 1 and Barkor
CCD-deletion mutant-fused EGFP, and the fluorescence of GFP-Barkor CCD
deletion (green) and RFP-Beclin 1 (red) was observed.
Sun et al. PNAS December 9, 2008 vol. 105 no. 49 19215
BIOCHEMISTRY
mutant lacking its CCD failed to localize to autophagosomes and
failed to direct Beclin 1 to autophagosomes (Fig. 5E X–XII).
Therefore, complex formation of Barkor and Beclin 1 is required
for their localization to autophagosomes.
Discussion
Barkor Promotes Autophagy Through Interaction with Beclin 1. In this
work, we reported the purification of the Beclin 1 complex from
human cells. In addition to its core components of Beclin 1, PI3KC3
and p150, and a known autophagy regulatory protein UVRAG, a
unique protein Barkor has also been identified in this complex.
Barkor interacts with Beclin 1 directly through its central CCD in
a way similar to the Beclin 1–UVRAG interaction. Consequently,
Barkor andUVRAGcompete with each other for their interaction
with Beclin 1 and actually form distinct complexes in mammalian
cells. Barkor seems to be critical for mammalian autophagy because
knockdown of this protein from mammalian cells compromises
their ability to activate autophagy in response to nutrient
deprivation and bacterial infection. Overexpression of Barkor
leads to autophagy activation and augmentation of autophagosome
formation. Finally, the Barkor–Beclin 1 interaction is
required for their localization to autophagosomes.
Barkor Could Be the Mammalian Functional Ortholog of Atg14 in
Yeast. Based on the sequence alignment and functional similarity,
Barkor is a good candidate to be the mammalian functional
ortholog of Atg14, the autophagy-specific regulatory factor for
Atg6/Beclin 1 in yeast (10, 11). Both Barkor and Atg14 possess a
zinc finger motif at the N terminus and a central CCD. Barkor also
shares 18% sequence identity and 32% sequence similarity with
yeast Atg14 (Fig. S3). Critically, both Barkor and Atg14 direct
Beclin 1/Atg6 to the autophagosome.
It is interesting to note that Barkor competes with UVRAG for
its binding to Beclin 1, similar to the interplay between Atg14 and
Vps38 in yeast. Coincidentally, a recent study suggests that
UVRAG is involved in late endosome fusion with the lysosome, a
phenomenon equivalent to vacuolar protein sorting in yeast,
through its interaction with the HOPS/Vps C complex (25). It is
possible that Barkor and UVRAG mediate the activity of Beclin 1
in autophagy and vacuole protein sorting, respectively. However,
evidence for the UVRAG role in autophagy (24) also demands an
alternative model. In this model, Barkor andUVRAGmay interact
with Beclin 1 in a stepwise manner and mediate its function in early
autophagosome formation and late autophagosome/lysosome fusion
sequentially.
Howthe autophagosome is formed is still an open question in this
field. The identification of Barkor and 2 other factors in the Beclin
1 complex will provide an opportunity perhaps to allow in vitro
reconstitution of PI3K function and autophagosome formation.
Materials and Methods
The full-length cDNAs of human Barkor (KIAA0831), Beclin 1, UVRAG, and
PI3KC3 were purchased from Open Biosystem. The shRNA coding sequence for
Barkor knockdown is GATCCCCGAAGGAAAGGTTAAGCCGATTCAAGAGATCGGCTTAACCTTTCCTTCTTTTTA.
The rest of the information about reagents,
cell lines, cell lysates preparation, tandem affinity purification, coimmunoprecipitation,
immunostaining, electronic microscopy, autophagy
analysis, and bacterial infection is listed in SI Experimental Procedures.
ACKNOWLEDGMENTS. We thank all of the Zhong laboratory members for
helpful discussionandtechnical assistance; Terje Johansen (University of Tromso),
JaeJung(University of Southern California), HaraldStenmark(Univeristy of Oslo),
Masaaki Komatsu (Juntendo University School of Medicine), and Denise Monack
(Stanford University School of Medicine) for reagents; Xiaodong Wang, Robert
Tjian, Randy Schekman, Daniel Klionsky, Jeremy Thorner, and Yulia Mostovoy for
critical reading of the manuscript; Nick V. Grishin at the University of Texas
Southwestern Medical Center for a bioinformatic analysis of Barkor; Dr. Yumay
Chen at the University of Texas Health Science Center at San Antonio and Abmart
at Shanghai for Barkor and Beclin 1 antibody production. The work was supported
in part by a New Investigator Award for Aging from the Ellison Medical
Foundation (to Q.Z.).
1. Cao Y, Klionsky DJ (2007) Physiological functions of Atg6/Beclin 1: A unique autophagyrelated
protein. Cell Res 17:839–849.
2. Levine B (2005) Eating oneself and uninvited guests: Autophagy-related pathways in
cellular defense. Cell 120:159–162.
3. Liang XH, et al. (1999) Induction of autophagy and inhibition of tumorigenesis by Beclin
1. Nature 402:672–676.
4. Kihara A, Kabeya Y, Ohsumi Y, Yoshimori T (2001) Beclin–phosphatidylinositol 3-kinase
complex functions at the trans-Golgi network. EMBO Rep 2:330–335.
5. Qu X, et al. (2003) Promotion of tumorigenesis by heterozygous disruption of the Beclin
1 autophagy gene. J Clin Invest 112:1809–1820.
6. Yue Z, Jin S, Yang C, Levine AJ, Heintz N (2003) Beclin 1, an autophagy gene essential for
early embryonic development, is a haploinsufficient tumor suppressor. Proc Natl Acad Sci
USA 100:15077–15082.
7. Karantza-Wadsworth V, et al. (2007) Autophagy mitigates metabolic stress and genome
damage in mammary tumorigenesis. Genes Dev 21:1621–1635.
8. Mathew R, et al. (2007) Autophagy suppresses tumor progression by limiting chromosomal
instability. Genes Dev 21:1367–1381.
9. Backer JM (2008) The regulation and function of class III PI3Ks: Novel roles for Vps34.
Biochem J 410:1–17.
10. Kihara A, Noda T, Ishihara N, Ohsumi Y (2001) Two distinct Vps34 phosphatidylinositol
3-kinase complexes function in autophagy and carboxypeptidase Y sorting in Saccharomyces
cerevisiae. J Cell Biol 152:519–530.
11. Obara K, Sekito T, Ohsumi Y (2006) Assortment of phosphatidylinositol 3-kinase complexes:
Atg14p directs association of complex I to the preautophagosomal structure in
Saccharomyces cerevisiae. Mol Biol Cell 17:1527–1539.
12. Suzuki K, Kubota Y, Sekito T, Ohsumi Y (2007) Hierarchy of Atg proteins in preautophagosomal
structure organization. Genes Cells 12:209–218.
13. Suzuki K, et al. (2001)Thepreautophagosomalstructure organizedbyconcerted functions
of APG genes is essential for autophagosome formation. EMBO J 20:5971–5981.
14. Pattingre S, et al. (2005) Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy.
Cell 122:927–939.
15. Gillooly DJ, et al. (2000) Localization of phosphatidylinositol 3-phosphate in yeast and
mammalian cells. EMBO J 19:4577–4588.
16. Klionsky DJ, Cuervo AM, Seglen PO (2007) Methods for monitoring autophagy from yeast
to human. Autophagy 3:181–206.
17. Klionsky DJ, et al. (2008) Guidelines for the use and interpretation of assays for monitoring
autophagy in higher eukaryotes. Autophagy 4:151–175.
18. Levine B, Deretic V (2007) Unveiling the roles of autophagy in innate and adaptive
immunity. Nat Rev 7:767–777.
19. Hernandez LD, Pypaert M, Flavell RA, Galan JE (2003) A Salmonella protein causes macrophage
cell death by inducing autophagy. J Cell Biol 163:1123–1131.
20. Birmingham CL, Smith AC, Bakowski MA, Yoshimori T, Brumell JH (2006) Autophagy
controls Salmonella infection in response to damage to the Salmonella-containing vacuole.
J Biol Chem 281:11374–11383.
21. Rioux JD, et al. (2007) Genome-wide association study identifies new susceptibility loci
for Crohn disease and implicates autophagy in disease pathogenesis. Nat Genet
39:596–604.
22. Komatsu M, et al. (2006) Loss of autophagy in the central nervous system causes neurodegeneration
in mice. Nature 441:880–884.
23. Furuya N,YuJ, ByfieldM,Pattingre S, LevineB(2005)Theevolutionarily conserveddomain
of Beclin 1 is required for Vps34 binding, autophagy, and tumor suppressor function.
Autophagy 1:46–52.
24. Liang C, et al. (2006) Autophagic and tumour suppressor activity of a novel Beclin
1-binding protein UVRAG. Nat Cell Biol 8:688–699.
25. Liang C, et al. (2008) Beclin 1-binding UVRAG targets the class C Vps complex to
coordinate autophagosome maturation and endocytic trafficking. Nat Cell Biol
10:776–787.
19216 www.pnas.org cgi doi 10.1073 pnas.0810452105 Sun et al.

Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes

Jill C. Milne^1,4, Philip D. Lambert^1,4, Simon Schenk^2,4, David P. Carney¹, Jesse J. Smith¹, David J. Gagne¹, Lei Jin¹, Olivier Boss¹, Robert B. Perni¹, Chi B. Vu¹, Jean E. Bemis¹, Roger Xie¹, Jeremy S. Disch¹, Pui Yee Ng¹, Joseph J. Nunes¹, Amy V. Lynch¹, Hongying Yang¹, Heidi Galonek¹, Kristine Israelian¹, Wendy Choy¹, Andre Iffland¹, Siva Lavu¹, Oliver Medvedik¹, David A. Sinclair³, Jerrold M. Olefsky², Michael R. Jirousek¹, Peter J. Elliott¹ & Christoph H. Westphal¹

Ana Lucia M. Britto, Lars Josefsson, 2 Eliuna Scemes, Maria Aparecida Visconti, and Ana Maria de L. Castrucci

ABSTRACT. The effects of either cation removal or ionic channel blockade were determined on the doseresponse curve (DRC) to PCH (pigment-concentrating hormone) in Macrobmchium potiuna erythrophores. In sodium-, potassium- and calcium-free salines, the pigment-aggregating responses to PCH were depressed; in the former condition, maximal aggregation was not achieved and the slope of the regression curve determined from the DRC was significantly different from control. Tetrodotoxin, verapamil or tetraethylammonium (TEA) treatments also diminished the pigment-aggregating responses to PCH, and the slopes of the regression curves were different from control in the presence of 10m6 M verapamil or 10m6 M TEA. Interestingly, the DRC determined in the absence of both sodium and calcium ions was not significantly different from control. When verapamil was applied in sodium-free conditions, maximal aggregation was prevented. The erythrophore resting membrane potential ranged from -62 mV to - 78 mV and did not vary during PCH-induced pigment aggregation as compared to the control. Our results suggest that transient modifications of potassium equilibrium potential may interfere with PCH signal transduction, revealing a more relevant role of potassium in the process, and that a sodium influx and an intracellular calcium mobilization are necessary to maintain a cytosolic balance between the ions for normality of PCH-induced responses. (COMP BIOCHEM PHYSIOL 113A;4:351-359, 1996)

A single mutation in the castor 9-18:0-desaturase
changes reaction partitioning from desaturation
to oxidase chemistry
Jodie E. Guy*, Isabel A. Abreu†, Martin Moche‡, Ylva Lindqvist*, Edward Whittle†, and John Shanklin†§
*Department of Medical Biochemistry and Biophysics, Division of Molecular Structural Biology, Karolinska Institutet, Tomtebodava¨gen 6,
S-171 77 Stockholm, Sweden; †Department of Biology, Brookhaven National Laboratory, Upton, NY 11973; and ‡Department of Medical
Biochemistry and Biophysics and Structural Genomics Consortium, Karolinska Institutet, S-171 77 Stockholm, Sweden
Edited by Christopher R. Somerville, Carnegie Institution of Washington, Stanford, CA, and approved September 28, 2006 (received for review
August 17, 2006)
Sequence analysis of the diiron cluster-containing soluble desaturases
suggests they are unrelated to other diiron enzymes; however,
structural alignment of the core four-helix bundle of desaturases
to other diiron enzymes reveals a conserved iron binding
motif with similar spacing in all enzymes of this structural class,
implying a common evolutionary ancestry. Detailed structural
comparison of the castor desaturase with that of a peroxidase,
rubrerythrin, shows remarkable conservation of both identity
and geometry of residues surrounding the diiron center, with
the exception of residue 199. Position 199 is occupied by a threonine
in the castor desaturase, but the equivalent position in
rubrerythrin contains a glutamic acid. We previously hypothesized
that a carboxylate in this location facilitates oxidase chemistry in
rubrerythrin by the close apposition of a residue capable of
facilitating proton transfer to the activated oxygen (in a hydrophobic
cavity adjacent to the diiron center based on the crystal
structure of the oxygen-binding mimic azide). Here we report that
desaturase mutant T199D binds substrate but its desaturase activity
decreases by 2 103-fold. However, it shows a >31-fold
increase in peroxide-dependent oxidase activity with respect toWT
desaturase, as monitored by single-turnover stopped-flow spectrometry.
A 2.65-Å crystal structure of T199D reveals active-site
geometry remarkably similar to that of rubrerythrin, consistent
with its enhanced function as an oxidase enzyme. That a single
amino acid substitution can switch reactivity from desaturation to
oxidation provides experimental support for the hypothesis that
the desaturase evolved from an ancestral oxidase enzyme.
binuclear diiron enzyme
Nonheme diiron-containing four-helix-bundle proteins possess
the ability to functionalize unactivated C-H groups and
mediate a diversity of chemical reactions including oxidation,
hydroxylation, desaturation, and epoxidation (1, 2). A wealth of
mechanistic information is available from various diironcontaining
proteins including methane monooxygenases, 9
desaturases, ribonucleotide reductases, rubrerythrins, alternate
oxidases, ferritins, and bacterioferritins (1–3).
The diiron-containing proteins are highly divergent in their
amino acid sequences, with identities typically falling below that
necessary for conventional phylogenetic analysis. However,
when the analysis is restricted to the four helices that coordinate
the diiron active site, the amino acid identity rises to 16–31% (4).
A shared diiron-binding motif within the conserved four-helix
bundle is involved in oxygen chemistry. The reactions have been
described as occurring in two phases, an oxygen activation phase
followed by reaction phases (1). Oxygen activation likely placed
strong evolutionary constraints on the organization of the diiron
center, whereas the reaction phases exhibit great diversity of
functional outcome. In addition to their individual catalytic
reactions, rubrerythrin, methane monooxygenase, ribonucleotide
reductase, and the 9 desaturase have also been shown to
reduce dioxygen to water (4–6). Based on these similarities,
Gomes et al. (4) proposed that the four-helix bundle diiron
proteins arose from a common ancestor that bound activated
oxygen species and reduced them to water. This hypothetical
oxidase enzyme is thought to have appeared at the transition
from anaerobic to aerobic environment, 2.5 billion years ago.
We previously performed a structural comparison of the
active site of the 9 desaturase with that of rubrerythrin, an
NAD(P)H peroxidase, which revealed remarkable similarity of
the diiron ligands (7). Based on this structural analysis we
proposed that residue 199, which occupies a location adjacent to
the diiron site and abuts the hydrophobic substrate binding
cavity, plays a key role in determining the chemical outcome of
the enzyme (7). In the desaturase it is occupied by threonine, and
in the rubrerythrin it is occupied by a glutamic acid. In this work
we report that the T199D mutant of the 9 desaturase shows
greatly reduced desaturation activity but increases its oxidase
activity by 31-fold with respect to theWT desaturase. A crystal
structure of the T199D mutant is presented that shows very close
active-site similarity to rubrerythrin, consistent with its change
in functionality.
Results and Discussion
Structural alignment of the reduced azide complexes of 9
desaturase and rubrerythrin (8) revealed similarities with respect
to the position and identity of iron binding ligands and the
position of the azide adduct (7) (Fig. 1). The single major
difference in the active site is the identity of the residue
corresponding to threonine-199 in the desaturase, which is a
glutamic acid in rubrerythrin. The side chain of the residue
occupying this position faces the bound azide that mimics the
binding site of molecular oxygen. Thus, the desaturase contains
threonine, a poor proton donor, whereas rubrerythrin contains
a glutamic acid, which facilitates proton transfer. We previously
hypothesized that the presence or absence of a proton donor in
this position might influence the partitioning of chemical reactivity
of the diiron site between desaturation and oxidase chemistry
(7). Thus, we engineered mutations at position 199 into the
desaturase to replace threonine with either glutamic or aspartic
acid and compared the desaturase and oxidase activity of these
mutants to those of WT 9 desaturase.
Author contributions: Y.L. and J.S. designed research; J.E.G., I.A.A., M.M., E.W., and J.S.
performed research; J.E.G., I.A.A., Y.L., E.W., and J.S. analyzed data; and J.S. wrote the
paper.
The authors declare no conflict of interest.
This article is a PNAS direct submission.
Data deposition: The atomic coordinates and structure factors have been deposited in the
Protein Data Bank, www.pdb.org (PDB ID code 2J2F).
§To whom correspondence should be addressed. E-mail: shanklin@bnl.gov.
© 2006 by The National Academy of Sciences of the USA
17220–17224 PNAS November 14, 2006 vol. 103 no. 46 www.pnas.org cgi doi 10.1073 pnas.0607165103
T199D and T199E mutants were expressed as soluble proteins
in Escherichia coli and purified with similar yields as WT 9
desaturase. Purified proteins were straw yellow in appearance,
and their spectra showed absorption features in the 300- to
500-nm range characteristic of ligand-to-metal charge transfer
bands characteristic of oxidized WT 9 desaturase (9). Mutants
T199D and T199E showed reductions of 2 103 in their rates
of desaturation (Table 1). Because T199D and T199E mutations
are adjacent to the substrate binding cavity, we tested for
possible changes in chain length specificity; however, neither
mutant showed any increased preference for either 16:0- or
14:0-ACP.
The introduction of a carboxylate at position 199 introduces a
charged residue into a primarily hydrophobic substrate binding
channel, raising the possibility that desaturation is prevented
because the 18:0-ACP substrate is unable to bind to the T199D
mutant desaturase. We therefore tested whether T199D is able
to bind substrate with the use of HPLC size-exclusion chromatography
performed in the presence of high salt to prevent
nonphysiological electrostatic enzyme–substrate association
(10). WT desaturase and the T199D mutant both show an
5-kDa increase in molecular mass when incubated with 18:0-
ACP (Table 2) but no change when incubated with unacylated
holo-ACP, indicating that both WT and T199D are capable of
binding substrate. These data suggest that loss of desaturation
activity of T199D does not result from an inability to bind
substrate.
If replacement of the hydroxy-containing threonine for carboxylate
functionality in mutants T199E or T199D increases
rubrerythrin-like catalysis, we predicted they should exhibit
enhanced capacity to reduce peroxide to water. Thus, we considered
various approaches to measuring the rate of peroxide
reduction in the WT 9 desaturase and the T199 mutants. To
perform the experiment physiologically requires the presence of
the natural electron donor ferredoxin and its reductase, ferredoxin
NADPH( ) oxidoreductase. However, ferredoxin and
ferredoxin NADPH( ) oxidoreductase contain chromophores
that mask the ligand-to-metal charge transfer bands of the 9
desaturase, preventing the monitoring of their rate of appearance
upon reoxidation of the desaturase. In addition, the use of
the physiological electron transport chain was discounted because
uncoupling of the electron transport chain when a nonnatural
substrate was provided to the desaturase has been
reported (11). However, an unusual property of the desaturase
is that its autooxidation rate in the absence of substrate is
103-fold slower that those of other diiron proteins such as the
R2 component of ribonucleotide reductase or the hydroxylase
component of methane monooxygenase (6). The relative stability
of reduced desaturase allowed us to separate it from excess
reductant by size-exclusion chromatography. Time-resolved single-
turnover reoxidation experiments were then performed by
reacting the reduced desaturase with various concentrations of
peroxide in a stopped-flow spectrophotometer. The peroxidedependent
reoxidation rate of the desaturase was determined for
WT, T199E, and T199D (see Table 1). A previous report
established that 4e -reduced 9 desaturase–substrate complex is
capable of reducing dioxygen to water (6); in this study we
observed a peroxide-dependent rate of desaturase reoxidation in
the absence of bound substrate (Fig. 2). The reoxidation rate
increased only modestly, by 30%, upon substitution of a
glutamic acid at position 199. However, the introduction of an
aspartic acid at position 199 resulted in a 31-fold increase in the
reoxidation rate.
A scheme representing the oxidase activity described in these
experiments is shown in Fig. 3.
The result that the aspartic acid substitution had a substantial
effect whereas substitution with glutamic acid had little effect
suggests that the active-site geometry attained by the T199D
mutant is better suited to reducing peroxide. To investigate the
relative position and orientation of the aspartic acid side chain
in T199D with that of WT desaturase and of rubrerythrin we
crystallized T199D and solved its structure at 2.65Å(Table 3 and
Fig. 4). No significant conformational changes beyond the
Fig. 1. Crystal structures of the reduced azide complexes of desaturase
(Upper) and rubrerythrin (Lower).
Table 1. Activities of desaturase enzymes
Enzyme
Desaturation with
18:0-ACP Oxidation with H2O2
kcat,* min 1
Fold
WT
Rate constant,†
M 1 s 1
Fold
WT
T199 (WT) 42.3 (1.6) — 3.6 103 —
T199E 0.022 (0.013) 10 3 4.5 103 1.3
T199D 0.021 (0.011) 10 3 1.1 105 31
*Desaturase assays, with mean standard error in parentheses (n 3).
†Oxidation assay. Rate constants were obtained from the slope of curves in Fig.
2, and each estimate is composed of 14 or more separate experiments.
Table 2. Apparent molecular masses of desaturase preparations
Enzyme
Desaturase plus
(18:0-ACP,
Buffer Holo-ACP 18:0-ACP buffer)
T199 (WT) 72.81 (0.59) 71.48 (1.60) 77.30 (0.73) 4.50 (0.46)
T199D 73.20 (0.28) 72.26 (0.99) 78.36 (0.17) 5.16 (0.40)
Data are mean apparent molecular mass in kilodaltons, with standard
deviation in parentheses (n 3).
Guy et al. PNAS November 14, 2006 vol. 103 no. 46 17221
BIOCHEMISTRY
active-site region are seen between the T199D model (Fig. 4) and
previously published models of the reduced native castor desaturase.
The electron density in the region of the active site is
of excellent quality; however, as reported for previous desaturase
models, the N terminus and the regions comprising residues
205–215 and 338–348 show less well defined electron density.
The iron–iron distance of 4.2 Å is that of the diferrous iron
center, presumably resulting from reduction by the x-ray exposure
as also observed in previous desaturase structures (7, 19).
The electron density for the threonine-to-aspartic acid mutation
at position 199 is clearly visible in the active site of each
monomer. As shown in Fig. 4, the carboxyl group of D199
occupies a similar, although not identical, position to that of E97
in rubrerythrin and is well situated to facilitate proton transfer.
Because the main chain of the desaturase is 1 Å closer to the
diiron site at residue 199 than the equivalent residue 97 of the
rubrerythrin structure, the shorter side chain length of the
aspartate positioned its carboxylate in an approximately equivalent
position to that of E97 of rubrerythrin with respect to the
diiron site.
During refinement, difference density in the active site (Fig.
5), corresponding to a ligand bound both by the mutated D199
residue and the diiron center became apparent, coincident with
the azide binding position of the azide–desaturase complex. The
density was initially modeled as a water molecule, but significant
positive density remained after refinement. It was subsequently
found that the density could be described almost equally well by
modeling either two waters or a dioxygen molecule. The most
accurate description appears to lie somewhere between the two
as, unrestrained, the distance between the two oxygen atoms
refined to 1.4–1.5 Å. Precedence exists for both models, with the
reduced form of rubrerythrin (12) containing two waters, and
sulerythrin (13) and rubredoxin:oxygen oxidoreductase (14)
each describing a putative dioxygen coordinating iron center.
Although the most likely explanation is a combination of the two
states, it was ultimately decided to model the density as two
waters because of the limited resolution of the structure. After
refinement this resulted in a relatively short OOO distance of
Fig. 2. Pseudo first-order rate constants and H2O2 concentration dependency
for the WT (F), T199E (▫), and T199D (E) mutant proteins determined
at 10°C.
Fig. 3. A schematic to describe the reaction of the desaturase T199D.
Table 3. Crystallography data collection and
refinement summary
Measurement Value
Data collection
Space group P212121
Cell axis a, Å 82.05
Cell axis b, Å 145.77
Cell axis c, Å 193.25
No. of molecules in asymmetric unit 6
Resolution, Å 2.65
Rsym 0.093 (0.474)
I/ 9.6 (2.3)
Completeness 98.4 (98.4)
Refinement
Refinement program REFMAC5
TLS model 6 TLS groups
Reflections in working set 68,033
Reflections in test set 3,388
R-factor, % 24.0
Rfree, % 27.1
No. of atoms modeled 17,049
No. of irons 12
No. of waters 150
Average B-factor protein 36.2
Average B-factor solvent 17.3
rmsd from ideals
Bonds, Å 0.016
Angles, ° 1.37
Ramachandran plot
Most favored, % 90.3
Additionally allowed, % 9.1
Generously allowed, % 0.3
Disallowed, % 0.3
Statistics for the highest-resolution shell are given in parentheses where
appropriate.
Fig. 4. A view of the superimposed active sites of the desaturase T199D
mutant (green) and of reduced rubrerythrin (blue), showing the similar position
of the putative proton donor groups.
17222 www.pnas.org cgi doi 10.1073 pnas.0607165103 Guy et al.
between 2.2 and 2.4 Å. We do not rule out the possibility that the
density could be that of a dioxygen species, particularly as the
binding site is very similar to that of the peroxo-mimic azide in
both desaturase and rubrerythrin.
In the model (Fig. 4), the waters W2 interacts with OD1 of the
mutated Asp-199 residue at a distance of 2.4 Å, whereas W1
interacts very weakly at a distance of 3.2 Å. Both also interact
with the diiron center, W2 binding at a distance of 2.3 Å to Fe2
and W1 interacting more weakly with a distance of 2.7–2.9 Å to
Fe1. W2 is also within hydrogen bonding distance of OE2 of
residue Glu-229. In this model, the apparent difference in water
binding relative to WT and its similarity to rubrerythrin correlates
with the observed change in functionality and supports
Yoon and Lippard’s suggestion (15) that the amount of accessible
water in nonheme diiron(II) enzymes might act as a control
element for achieving diverse functions using a shared structural
motif. Beyond the mutated residue and the putative waters, no
further structural changes are seen in the active site when
compared with the native desaturase structure.
Gomes et al. (4) previously proposed that the four-helix bundle
diiron protein family evolved from an ancestral rubrerythrin-like
oxidase enzyme that was responsible for reducing oxygen to
water. Correspondence of the identity and relative orientation of
residues in the actives site of the desaturase and rubrerythrin are
remarkable in light of the absence of overall detectable homology
between the two enzyme families. Results presented here
demonstrate that conversion of the hydroxy functionality of T199
to carboxylate functionality in the T199D mutant diminished
desaturase activity by 2 103-fold and increased the oxidase
activity by 31-fold. Effecting a profound change in chemical
reactivity of an enzyme by a single amino acid substitution, i.e.,
loss of desaturase activity accompanied by a large increase in
oxidase activity, provides experimental support for the hypothesis
that the desaturase evolved from an ancestral oxidase
enzyme.
Materials and Methods
Desaturase Expression, Purification, and Enzyme Assay. Castor recombinant
desaturase was generated by expression in plasmid
pET9d in E. coli BL21(DE3) that were grown in LB media in a
New Brunswick Scientific (Edison, NJ) G25 incubator shaker at
37°C until OD600 0.5, at which time isopropyl- -Dthiogalactopyranoside
was added to 0.1 mM (16). The temperature
was lowered to 30°C, and the culture was shaken at 275 rpm
for a further 4 h. Cells were collected by centrifugation, resuspended
in 5 vol of 7 mMHepes, 7 mMMes, 7 mMNaOAc, 4 mM
MgCl2, and 6 Kunitz units ml DNase I (pH 7.4), and lysed by
passage through a French pressure cell with a 104-psi pressure
drop. The lysate was clarified by centrifugation at 45,000 g for
30 min. The supernatant was applied to a 12-ml Poros 20 CM
column equilibrated with 7 mM Hepes, 7 mM Mes, and 7 mM
NaOAc (pH 7.4) (equilibration buffer). After loading, the
column was washed with 10 vol of equilibration buffer before
elution with a linear gradient of 0–600mMNaCl in equilibration
buffer. The resulting desaturase was judged to be 90% pure by
SDS PAGE. The resulting enriched desaturase was concentrated
with the use of an Amicon PM30 ultrafilter (Milliport,
Framingham, MA) and subjected to HPLC size-exclusion chromatography
with the use of a preparative G-3000SW (Toso
Haas, Montgomeryville, PA) developed with 20 mM Hepes 70
mM NaCl (pH 7.0). Castor 9-18:0-ACP desaturase variants
were assayed with [1-14C]18:0-ACP substrate with the use of
recombinant spinach ACP-I (17). Methyl esters of fatty acids
were analyzed by argentation TLC, and radioactivity in products
was quantified as previously described (18). 9-18:0-ACP desaturase
assays were performed in triplicate.
Stopped-Flow Kinetic Experiments. TheWT and mutant desaturase
proteins at concentrations between 5 and 8 mg ml in 0.5 MCAT
buffer {CAT designates equal proportions of Mes [2-(Nmorpholino)
ethanesulfonic acid 4-morpholineethanesulfonic
acid], Hepes [4-(2-hydroxyethyl) piperazine-1-ethanesulfonic
acid] and sodium acetate}, i.e., 167 mM Mes, 167 mM Hepes,
and 167 mM sodium acetate (pH 7.5) were used for these
experiments. Desaturase preparations were made anaerobic by
repeated cycles of vacuum and equilibration with oxygen-free
argon with the use of a Schlenk line. The resulting desaturase
solutions were reduced, as monitored by the decrease in absorption
at 340 nm, by titration with sodium dithionite in the presence
of 0.4 M CAT (pH 7.5) supplemented with 0.25 mM methyl
viologen. The reduced protein was then applied to a PD10
column (Amersham Pharmacia, Uppsala, Sweden) equilibrated
with 50 mM CAT 70 mM NaCl (pH 7.5) to eliminate excess
sodium dithionite and methyl viologen. Protein eluting from this
column was used for stopped-flow spectrometry. Reoxidation of
desaturase by hydrogen peroxide was monitored by an increase
in absorption of the 340-nm ligand-to-metal charge transfer
band, with the use of a KinTek Stopped-Flow SF-2001. All
measurements were made by using 0.1–5 mM H2O2 solutions in
50 mM CAT 70 mM NaCl (pH 7.5) at 10°C. Data analysis was
performed by using IGOR Pro computer software (WaveMetrics,
Lake Oswego, OR).
Desaturase–Substrate Complex. Purified WT or T199D mutant
desaturase ( 50 M) was incubated with 18:0-ACP substrate in
20 mM Hepes 450 mM NaCl (pH 7.0) for 30 min. The elution
times of either native enzyme or enzyme incubated with substrate
were estimated after passage through a G3000SWXL
size-exclusion column developed with the same buffer. Apparent
molecular masses were estimated based on comparison of elution
times of proteins of known masses.
Crystallization and Data Collection. Crystallizations were performed
by the hanging drop vapor diffusion method, using
conditions very similar to those described previously for the
native desaturase (19). Before crystallization, the protein was
concentrated to 14–16 mg ml 1 in 20 mM Hepes (pH 7.0) 70
mM NaCl. Crystals were obtained at 20°C from a well solution
of 0.08 M cacodylate buffer (pH 5.4), 0.2 M magnesium acetate,
75mMammonium sulfate, 16–18% (wt vol) polyethylene glycol
4000, and 0.2% -octyl glucoside, using a drop consisting of 5 l
of the well mixed with 5 l of protein solution. Under these
conditions crystals grew in 2–4 days, reaching a final size of
Fig. 5. The active site of the T199D mutant, showing an omitmap(contoured
at 3 ) of the difference density that was ultimately modeled as two water
molecules.
Guy et al. PNAS November 14, 2006 vol. 103 no. 46 17223
BIOCHEMISTRY
200 300 20 m. Crystals were cryoprotected by soaking
for 30 sec in well solution supplemented with 25% (vol vol)
glycerol. The crystals belong to the orthorhombic space group
P212121, with unit cell dimensions a 82.05, b 145.77, and c
193.25 Å, and contain six monomers per asymmetric unit.
Data were collected at cryogenic temperatures by using
beamline ID14-3 of the European Synchrotron Research Facility
(Grenoble, France). The data were collected at a wavelength of
0.931 Å with an oscillation angle of 0.2° and were processed by
using MOSFLM (20) and SCALA (21) from the CCP4 suite (22).
Data collection and processing statistics are summarized in
Table 3.
Structure Determination and Refinement. The structure of the
T199D mutant was solved by molecular replacement implemented
in the program MOLREP (23) by using the original 9
desaturase structure (19) (Protein Data Bank ID code 1AFR) as
the search model. The model obtained was refined by using a
combination of simulated annealing with the use of the Crystallography
and NMR System (CNS) software suite (24) and
refinement by the maximum-likelihood method in REFMAC5
(15). Atomic displacement parameters were refined in REFMAC
by the TLS (translation, liberation, screw) method, with
each of the six monomers in the asymmetric unit treated as a
single TLS group. Tight 6-fold NCS restraints were used
throughout refinement to maximize the observation-toparameter
ratio. Graphics operations were performed in COOT
(25), and water molecules were manually added to the model in
COOT by using the 2Fo Fc map. Annealed omit maps were
calculated in CNS (24) and used to confirm the content of the
active site, as well as the reduced state of the diiron center.
The geometry of the refined structure was checked with
PROCHECK (26), and the refined parameters are summarized
in Table 3. The coordinates of the final model, in addition to the
structure factors, have been deposited in the Protein Data Bank
with the ID code 2J2F. All structural figures were produced by
using PyMol (27).
We thank Drs. L. Que, D. M. Kurtz, and D. Cabelli for helpful discussion.
We acknowledge the European Synchrotron Research Facility for beam
time allocation. This work was supported by the Office of Basic Energy
Sciences of the U.S. Department of Energy and the Laboratory Directed
Research and Development Program of the Brookhaven National Laboratory
(Project 03-094) (J.S.) and by the Swedish Foundation for
International Cooperation in Research and Higher Education and the
Swedish Research Council (Y.L.).
1. Wallar BJ, Lipscomb JD (1996) Chem Rev 96:2625–2657.
2. Que L, Jr, Tolman WB (2002) Angew Chem Int Ed 41:1114–1137.
3. Shanklin J, Cahoon EB (1998) Annu Rev Plant Physiol Plant Mol Biol
49:611–641.
4. Gomes CM, Le Gall J, Xavier AV, TeixeiraM(2001) Chembiochem 2:583–587.
5. Gassner GT, Lippard SJ (1999) Biochemistry 38:12768–12785.
6. Broadwater JA, Ai J, Loehr TM, Sanders-Loehr J, Fox BG (1998) Biochemistry
37:14664–14671.
7. Moche M, Shanklin J, Ghoshal A, Lindqvist Y (2003) J Biol Chem 278:25072–
25080.
8. Jin S, Kurtz DM, Jr, Liu ZJ, Rose J, Wang BC (2002) J Am Chem Soc
124:9845–9855.
9. Fox BG, Shanklin J, Somerville C, Munck E (1993) Proc Natl Acad Sci USA
90:2486–2490.
10. Haas JA, Fox BG (2002) Biochemistry 41:14472–14481.
11. Haas JA, Fox BG (1999) Biochemistry 38:12833–12840.
12. Kurtz DM, Jr (2006) J Inorg Biochem 100:679–693.
13. Fushinobu S, Shoun H, Wakagi T (2003) Biochemistry 42:11707–11715.
14. Frazao C, Silva G, Gomes CM, Matias P, Coelho R, Sieker L, Macedo S, Liu
MY, Oliveira S, Teixeira M, et al. (2000) Nat Struct Biol 7:1041–1045.
15. Yoon S, Lippard SJ (2004) J Am Chem Soc 126:16692–16693.
16. Whittle E, Shanklin J (2001) J Biol Chem 276:21500–21505.
17. Cahoon EB, Shanklin J (2000) Proc Natl Acad Sci USA 97:12350–12355.
18. Cahoon EB, Coughlan S, Shanklin J (1997) Plant Mol Biol 33:1105–1110.
19. Lindqvist Y, Huang W, Schneider G, Shanklin J (1996) EMBO J 15:4081–4092.
20. Leslie AG (1999) Acta Crystallogr D 55:1696–1702.
21. Evans PR (1993) Data Collection and Processing (Daresbury Laboratory,
Warrington, UK).
22. Collaborative Computational Project, Number 4 (1994) Acta Crystallogr D
50:760–763.
23. Vagin A, Teplyakov A (1997) J Appl Crystallogr 30:1022–1025.
24. Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve
RW, Jiang JS, Kuszewski J, Nilges M, Pannu NS, et al. (1998) Acta Crystallogr
D 54:905–921.
25. Emsley P, Cowtan K (2004) Acta Crystallogr D 60:2126–2132.
26. Laskowski RA, MacArthur MW, Moss DS, Thornton JM (1993) J Appl
Crystallogr 26:283–291.
27. DeLano WL (2002) The PyMOL Molecular Graphics System (DeLano Scientific,
San Carlos, CA).
17224 www.pnas.org cgi doi 10.1073 pnas.0607165103 Guy et al.